Strain: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi

Symbol: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1Mcwi
Strain: FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi-Rab38em1
Substrain: Mcwi
Ontology ID: RS:0002431
Alleles: Rab38em1Mcwi
Also known as: FHH.BN-Rab38em1Mcwi; FHH.BN1-Rab38-Rab38em1Mcwi; FHH.BN-(Rab38)Mcwi-Rab38em1Mcwi; FHH.BN-(D1Hmgc14-D1Hmgc15)Mcwi-Rab38em1Mcwi
Type: mutant
Source: PhysGen Knockouts
Origin: This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.
Last Known Status: Cryopreserved Sperm (as of 2017-01-26)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01152,072,716 - 152,153,449RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01158,385,888 - 158,466,621RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41144,783,919 - 144,864,573RGD_MAPPER_PIPELINERGSC3.4

Mutant Strains




Experimental Data Annotations
References - curated

Region


Additional Information

Nomenclature History
 
More on this Strain
Strain Nomenclature
Strain Registration

RGD Object Information
RGD ID: 4139877
Created: 2010-08-20
Species: Rattus norvegicus
Last Modified: 2017-01-26
Status: ACTIVE